sample custom papers (249 essays)

America is fighting a battle which it can 't win and fighting in a place which it can 't leave . The people opposing the war are considered quislings . Student Protest at Madison On the next day after the Black Lions ambushed , anti war students were protesting against the presence of Dow Chemical in the campus . Dow Chemicals was the supplier of Napalm , the incendiary bomb which caused heavy civilian causalities and come to symbolize war cruelties . At the University of...

Nobel Foundation , n . d ) Top Ten Scientific s Heisenberg 's many contributions included : Uncertainty Principles (1927 ) Quantum Mechanics (1925 ) Molecular Exchange Force (1926 , 1927 ) Neutron-proton model of the nucleus (3 parts (1932 , 1933 ) Quantum field theory (2 parts (1929 , 1930 ) Ferromagnetism (1928 ) Hydrodynamics (1924 , 1948 ) S-matrix theory (3 parts (1943 , 1944 ) Multiple Processes (1936 , 1938 , 1949 ) Non-linear field equations (1953 , 1955 , 1957 (David C . Cassidy , n . d ) One of the excerpts from Heisenberg 's original regarding quantum theory shows ?p...

This concept appealed to some poor countries thus , they adopted this as a plan of their government . Two of such countries are China and Cuba . The year 1960 saw the start of innovations in technology and the sciences . It produced the deadly Hydrogen bomb . Humanity had discovered a means to annihilate itself . With the continued expansion of the Socialist ideology and coupled with the advent of thermonuclear weaponry , the capitalist West became more concerned . Thereafter , the United States became entangled...

Community psychology focuses on the way society makes its impact on an individual , concerning itself specifically on person-environment interactions . It centers its study on settings affects individuals , organizations , and society (``Community Psychology . 2007 ) The area which discusses how cognitive and psychological processes influence our dealing in tools and other objects in our environment is called the human factors psychology . This area is studied to enhance the design of objects in relation to the research results of the limitations and biases...

American government . Ibid , 483 . Walter Lippmann was one respected establishment academic who warned that the attempt to contain communism across the earth ``would wreck the constitution by necessarily creating an all-powerful president as commander in chief ' Ibid , 484 . The final revolutionary change that Truman instituted was the formation of NATO in 1949 . NATO represented America 's first military alliance with Europe since 1778 , clearly marking another radical break with America 's past . This mutually-reinforcing alliance was intended to make it...

The respondents were asked to indicate their responses by using a scale from 1 to 7 . For the ease of data analysis , the means for the self-concept and coping style measures were standardized to the same values to facilitate comparisons between groups . The rest of the data was treated to a regression analyses and descriptive statistics was also included to describe the demographic characteristics of the respondents . For each measured variable , the researchers compared each regional group to each other...

The protagonist 's patience and admiration to the flow of what seemed to be ``natural way of life ' has saved him from being off the scene of explicit exposure to the red light society which he later finds out to be a beneficial thing within the grasp of the May Fourth dilemma . Those who were behind the bars of desperation have been emotionally convicted in living in agony 's sagacity and apparently making them a part of the unidentified sinking...

There is this and that fact when in truth there are no such things . The student who does not know any better perfunctorily commit to heart these very tenets . In effect , ideas do not grow but are just passed on to different people . The worst part of it is that those who do well in this exercise are rewarded with good merit and praise . Exposition to a motley discourse is harmful only when it becomes merely an exercise of sending...

The transfer of goods from one region to another has been possible with much ease and using less time and energy on the part of the workers . Machines such as computer have also been used and communication has been made easier with the use of e-mail where different details can be passed on to several persons in an efficient manner . This has also come with the use of telephones and mobile phones . These channels have enhanced internal and external communication...

Use information read from a story to answer questions that follow (d ) Connect parts of story into making a whole (e ) Collaborate with other students in discussing the main ideas of stories read in class (f ) Explain the moral lessons of the stories read in class . [Blooms (Ed ) 1956] Set : Teacher introduces the lesson by displaying colorful pictures showing animal characters of stories found in the students ' story books , proceeds to pin the pictures on the black board for all...

Constable , 2003 . How to reveal to someone you are attracted to the truth There are several ways in which this can be achieved . The first step should be ensuring that the person is available and that he /she is single , after which you can proceed using any of the following ways : If you are the kind of person who is free and outgoing , you can decide to share your feeling over coffee or dinner . But if you are reserved and...

Running Head : TINY COLLEGE Tiny College [Name of the writer] [Name of the institution] [Name of the Professor] Tiny College In the Tiny College Relational Diagram , all of the relationships between the entities are 1 :M (one to many . Figure 1 . Tiny College Relational Diagram (Rob , 2007 ) The relationships and the business rules are explained below : COURSE : CLASS (1 :M ) The CLASS is generated because of the COURSE . There can be multiple number of classes of a single course . On...

Let S be the sample space for (X Y ) and for every element ? of S we have : E ( X Y ?S X ?Pr ?S X ?Pr EX EY E [ (X - EX )2] E [ (X - EX (X - EX )] Using algebraic expansion , we get E [ X2 - 2X ?EX (EX )2] E X2 - 2E (X ?EX E (EX )2 Using the rule that the expectation value of the sum is the sum of the expectation values EX2 - 2EX ?EX...

Statistics Understanding and Exploring Assumptions  Assumptions Required for Statistical Tests There are many assumptions that need to be made in any statistical tests . The assumptions usually give a guidance on how the study is to be carried out and the specific tests and procedures that need to be carried out in the statistical test . They also give the direction that the test is to take in terms of determining the sample to be considered , the research hypothesis and the hypothesis...

Running head : Transcriptome analysis Transcriptome analysis [Your name here] [Your university here] Primer design a ) First pair of primers The sequence : Size in bp of the amplified product : 371 bp Sequence of left primer : AGTCAGGGCAGAGCCATCTA Template of left primer : AGTCAGGGCAGAGCCATCTA Sequence of right primer : CAGCATCAGGAGTGGACAGA Template of right primer : TCTGTCCACTCCTGATGCTG b ) Second pair of primers The sequence : Size in bp of the amplified product : 394 bp Sequence of left primer : TCTGTCCACTCCTGATGCTG Template RNA for left primer : TCTGTCCACTCCTGATGCTG Sequence of right...