Transcriptome Analysis

Running head : Transcriptome analysis

Transcriptome analysis

[Your name here]

[Your university here]

Primer design

a ) First pair of primers

The sequence

Size in bp of the amplified product : 371 bp

Sequence of left primer : AGTCAGGGCAGAGCCATCTA

Template of left primer : AGTCAGGGCAGAGCCATCTA

Sequence of right primer : CAGCATCAGGAGTGGACAGA

Template of right primer : TCTGTCCACTCCTGATGCTG

b ) Second pair of primers

The sequence

Size in bp of the amplified product : 394 bp

Sequence of left primer : TCTGTCCACTCCTGATGCTG

Template RNA for left primer : TCTGTCCACTCCTGATGCTG

Sequence of right primer : TGCTCAAGGCCCTTCATAAT p

Template RNA for right primer : ATTATGAAGGGCCTTGAGCA

The primer pair intended for the DNA template cannot be used to amplify the mRNA template because there are no complementary sequences in the template that could be targeted by the primer pair . The primer pair intended for the DNA template cannot be used to amplify the DNA template because there are also no complementary sequences in the template that could be targeted by the primer pair . The RNA template is the transcribed sequence of the DNA template and therefore the sequences are complementary and thus the primer pair for an RNA template may not be the same

Real time RT-PCR pertains to the amplification technique that allows quantification of the targeted DNA molecule during the reaction (Parashar et al , 2006 . This technique is based on the principles of PCR , which employs primers that were designed to be complementary to the target template . In addition , the technique also involves a series of temperature changes , with each temperature allowing a specific reaction to...